Foundry120 atlas

← IBD microbiome

Multi-omics Reveal Vitamin D Regulation of Immune-Gut Microbiome Interactions and Tolerogenic Pathways in Inflammatory Bowel Disease [16S rRNA-seq]

Download from source ↗

Dataset overview

Participants 48
Samples 96
Reuse readiness 5.3/10 evidence-backed score

Multi-omics reveal vitamin D regulation of immune-gut microbiome interactions and tolerogenic pathways in inflammatory bowel disease.

Gubatan J, Sojwal RS, Ye J, Boye TL, Hoang JN, Fardeen T, Temby M, Rubin SJS, et al. · Cell reports. Medicine · 2026

Abstract

Loss of immune tolerance to the gut microbiome plays a pathogenic role in inflammatory bowel disease (IBD). How dietary factors alter host immune-gut microbiome interactions in IBD is unclear. Here, we apply multi-omics (immunoglobulin A or G and 16S rRNA sequencing [IgA-seq, IgG-seq], blood single-cell RNA sequencing [scRNA-seq], and immune repertoire sequencing) to investigate the effects of 12 weeks of vitamin D on host immune microbe interactions in patients with IBD. Vitamin D treatment associates with decreased disease activity and inflammatory markers and increased IgA-bound and decreased IgG-bound gut microbiota. Vitamin D alters the profiles of IgA-bound (increased Lachnospiraceae, Blautia) and IgG-bound (decreased Proteobacteria, Enterococcaceae) gut bacteria. Vitamin D increases B cell activating factor (BAFF) signaling between plasmacytoid dendritic cells and B cells, alters BCR and TCR clonotypes that associate with Ig-bound gut microbiota, and increases α4β7+ B and T regulatory cells. Our results demonstrate that vitamin D promotes immune tolerance to gut microbiota in patients with IBD. Clinical trial is registered under NCT04828031.

doi:10.1016/j.xcrm.2026.102703 ↗ PMID 41895287 ↗ PMC13130636 ↗

Study facts

Organism
human feces metagenome
Platform
Illumina MiSeq
Age group
adult
Disease groups
—
Anatomical sites
—

Data availability

Specific data assets have not been resolved from the source yet — see the source repository below for the full file listing.

Strengths & limitations for reuse

Strengths

  • Participant-to-sample mapping is available
  • Participant counts are documented
  • Sample counts are documented

Limitations

  • Not documented: raw reads are advertised
  • Not documented: feature/otu tables are advertised
  • Not documented: taxonomic tables are advertised
Extraction evidence & provenance

Each extracted field is shown with the source excerpt and location used to resolve it.

Assay

FieldValueEvidence
assay.paired_end True
using 2 × 250 sequencing on an Illumina MiSeq.

Section STAR Methods; IgA-Seq, IgG-Seq, and whole gut microbiome 16 S sequencing and processing, offset 51700
assay.platform Illumina MiSeq
using 2 × 250 sequencing on an Illumina MiSeq.

Section STAR Methods; IgA-Seq, IgG-Seq, and whole gut microbiome 16 S sequencing and processing, offset 51700
assay.primers_reported True
primer 515F/sequence GTGCCAGCMGCCGCGGTAA, primer 907R/sequence CCGTCAATTCCTTTGAGTTT

Section STAR Methods; IgA-Seq, IgG-Seq, and whole gut microbiome 16 S sequencing and processing, offset 51600
assay.read_depth_reported 1000
OTU tables were rarified at the sequencing depth of 1,000 sequences/sample.

Section STAR Methods; Microbiome analyses, offset 60200
assay.read_length 250
using 2 × 250 sequencing on an Illumina MiSeq.

Section STAR Methods; IgA-Seq, IgG-Seq, and whole gut microbiome 16 S sequencing and processing, offset 51700
assay.sequencing_type amplicon_16s inferred
Bacterial 16 S sequencing of the V4 and V5 regions ... were performed at Novogene using 2 × 250 sequencing on an Illumina MiSeq.

Section STAR Methods; IgA-Seq, IgG-Seq, and whole gut microbiome 16 S sequencing and processing, offset 51600
assay.target_region V4-V5
Bacterial 16 S sequencing of the V4 and V5 regions

Section STAR Methods; IgA-Seq, IgG-Seq, and whole gut microbiome 16 S sequencing and processing, offset 51600

Cohort

FieldValueEvidence
cohort.age_group adult
Patients who met inclusion criteria (adult patients (18 years or older) with inflammatory bowel disease (ulcerative colitis or Crohn’s disease)

Section STAR Methods; Vitamin D inflammatory bowel disease clinical trial NCT04828031, offset 47200
cohort.disease_activity_metadata_available True
Disease activity scores (partial Mayo score for ulcerative colitis, Harvey Bradshaw Index for Crohn’s disease) ... were collected at week 0 and week 12.

Section STAR Methods; Vitamin D inflammatory bowel disease clinical trial NCT04828031, offset 47800
cohort.study_design longitudinal
from 48 patients with inflammatory bowel disease before and after vitamin D intervention

Section study.overall_design, offset 850
cohort.total_participants 48
Stool IgA-Seq and IgG-seq (16S sequening) from 48 patients with inflammatory bowel disease before and after vitamin D intervention

Section study.overall_design, offset 850
cohort.treatment_exposure_documented True
Patients were then treated with 50,000 units of oral vitamin D (ergocalciferol) once per week for 12 weeks.

Section STAR Methods; Vitamin D inflammatory bowel disease clinical trial NCT04828031, offset 47600
cohort.treatment_response_metadata_available True
Disease activity scores ... quality of life scores ... were collected at week 0 and week 12.

Section STAR Methods; Vitamin D inflammatory bowel disease clinical trial NCT04828031, offset 47800

Specimens

FieldValueEvidence
specimens.inflamed_status_available True
Forty-eight patients with IBD completed the clinical trial and provided a full set of pre- and post-vitamin D treatment blood and stool samples.

Section Results; Vitamin D is associated with improved disease activity and stool inflammatory marker, offset 7600
specimens.longitudinal_sampling True
before and after vitamin D intervention

Section study.overall_design, offset 850
specimens.number_of_samples 96 computed
from 48 patients with inflammatory bowel disease before and after vitamin D intervention

Section study.overall_design, offset 850
specimens.participant_to_sample_mapping_available True inferred
Forty-eight patients with IBD completed the clinical trial and provided a full set of pre- and post-vitamin D treatment blood and stool samples.

Section Results; Vitamin D is associated with improved disease activity and stool inflammatory marker, offset 7600
specimens.sample_type stool
Stool IgA-Seq and IgG-seq (16S sequening) from 48 patients

Section study.overall_design, offset 820