Foundry120 atlas

← IBD microbiome

Multi-omics Reveal Vitamin D Regulation of Immune-Gut Microbiome Interactions and Tolerogenic Pathways in Inflammatory Bowel Disease

Download from source ↗

Dataset overview

Participants 48
Samples 96
Reuse readiness 5.9/10 evidence-backed score

Multi-omics reveal vitamin D regulation of immune-gut microbiome interactions and tolerogenic pathways in inflammatory bowel disease.

Gubatan J, Sojwal RS, Ye J, Boye TL, Hoang JN, Fardeen T, Temby M, Rubin SJS, et al. · Cell reports. Medicine · 2026

Abstract

Loss of immune tolerance to the gut microbiome plays a pathogenic role in inflammatory bowel disease (IBD). How dietary factors alter host immune-gut microbiome interactions in IBD is unclear. Here, we apply multi-omics (immunoglobulin A or G and 16S rRNA sequencing [IgA-seq, IgG-seq], blood single-cell RNA sequencing [scRNA-seq], and immune repertoire sequencing) to investigate the effects of 12 weeks of vitamin D on host immune microbe interactions in patients with IBD. Vitamin D treatment associates with decreased disease activity and inflammatory markers and increased IgA-bound and decreased IgG-bound gut microbiota. Vitamin D alters the profiles of IgA-bound (increased Lachnospiraceae, Blautia) and IgG-bound (decreased Proteobacteria, Enterococcaceae) gut bacteria. Vitamin D increases B cell activating factor (BAFF) signaling between plasmacytoid dendritic cells and B cells, alters BCR and TCR clonotypes that associate with Ig-bound gut microbiota, and increases α4β7+ B and T regulatory cells. Our results demonstrate that vitamin D promotes immune tolerance to gut microbiota in patients with IBD. Clinical trial is registered under NCT04828031.

doi:10.1016/j.xcrm.2026.102703 ↗ PMID 41895287 ↗ PMC13130636 ↗

Study facts

Organism
Homo sapiens
Platform
Illumina MiSeq
Age group
adult
Disease groups
Crohn's disease, Ulcerative colitis
Anatomical sites
—

Data availability

Specific data assets have not been resolved from the source yet — see the source repository below for the full file listing.

Strengths & limitations for reuse

Strengths

  • Participant-to-sample mapping is available
  • Participant counts are documented
  • Sample counts are documented

Limitations

  • Not documented: raw reads are advertised
  • Not documented: feature/otu tables are advertised
  • Not documented: taxonomic tables are advertised
Extraction evidence & provenance

Each extracted field is shown with the source excerpt and location used to resolve it.

Assay

FieldValueEvidence
assay.paired_end True
using 2 × 250 sequencing on an Illumina MiSeq

Section STAR Methods: 16S sequencing, offset 60500
assay.platform Illumina MiSeq
performed at Novogene using 2 × 250 sequencing on an Illumina MiSeq

Section STAR Methods: 16S sequencing, offset 60500
assay.primers_reported True
primer 515F/sequence GTGCCAGCMGCCGCGGTAA, primer 907R/sequence CCGTCAATTCCTTTGAGTTT

Section STAR Methods: 16S sequencing, offset 60350
assay.read_depth_reported 1000
OTU tables were rarified at the sequencing depth of 1,000 sequences/sample.

Section STAR Methods: microbiome analyses, offset 63500
assay.read_length 250
using 2 × 250 sequencing on an Illumina MiSeq

Section STAR Methods: 16S sequencing, offset 60500
assay.sequencing_type amplicon_16s
Bacterial 16 S sequencing of the V4 and V5 regions

Section STAR Methods: 16S sequencing, offset 60300
assay.target_region V4-V5
Bacterial 16 S sequencing of the V4 and V5 regions

Section STAR Methods: 16S sequencing, offset 60300

Cohort

FieldValueEvidence
cohort.age_group adult
adult patients (18 years or older) with inflammatory bowel disease

Section STAR Methods: clinical trial participants, offset 55000
cohort.crohns_disease_participants 21 computed
About 56.3% of patients had ulcerative colitis (UC), whereas 43.7% had Crohn disease (CD).

Section Results: clinical trial outcomes, offset 6700
cohort.disease_activity_metadata_available True
a decline in disease activity scores (partial mayo score for ulcerative colitis, −3.2; Harvey Bradshaw Index for Crohn disease, −3.3)

Section Results: clinical trial outcomes, offset 7200
cohort.study_design longitudinal
from 48 patients with inflammatory bowel disease before and after vitamin D intervention

Section study.overall_design, offset 1100
cohort.total_participants 48
Stool IgA-Seq and IgG-seq (16S sequening) from 48 patients with inflammatory bowel disease before and after vitamin D intervention

Section study.overall_design, offset 1100
cohort.treatment_exposure_documented True
Patients were then treated with 50,000 units of oral vitamin D (ergocalciferol) once per week for 12 weeks.

Section STAR Methods: clinical trial participants, offset 55500
cohort.treatment_response_metadata_available True
Twelve weeks of 50,000 units of oral vitamin D once per week led to a 20 point increase in serum 25(OH)D levels

Section Results: clinical trial outcomes, offset 7100
cohort.ulcerative_colitis_participants 27 computed
About 56.3% of patients had ulcerative colitis (UC), whereas 43.7% had Crohn disease (CD).

Section Results: clinical trial outcomes, offset 6700

Specimens

FieldValueEvidence
specimens.inflamed_status_available True
mean fecal calprotectin was 1,046.3 μg/g

Section Results: clinical trial outcomes, offset 7000
specimens.longitudinal_sampling True
At the time of enrollment (week 0), patients had blood and stool samples collected... Blood and stool samples were collected at the end of study (week 12).

Section STAR Methods: clinical trial participants, offset 55700
specimens.number_of_samples 96 computed
from 48 patients with inflammatory bowel disease before and after vitamin D intervention

Section study.overall_design, offset 1100
specimens.participant_to_sample_mapping_available True
Forty-eight patients with IBD completed the clinical trial and provided a full set of pre- and post-vitamin D treatment blood and stool samples

Section Results: clinical trial outcomes, offset 6400
specimens.sample_type stool
Stool IgA-Seq and IgG-seq (16S sequening)

Section study.overall_design, offset 1030