Multi-omics Reveal Vitamin D Regulation of Immune-Gut Microbiome Interactions and Tolerogenic Pathways in Inflammatory Bowel Disease
Download from source ↗Dataset overview
Multi-omics reveal vitamin D regulation of immune-gut microbiome interactions and tolerogenic pathways in inflammatory bowel disease.
Abstract
Loss of immune tolerance to the gut microbiome plays a pathogenic role in inflammatory bowel disease (IBD). How dietary factors alter host immune-gut microbiome interactions in IBD is unclear. Here, we apply multi-omics (immunoglobulin A or G and 16S rRNA sequencing [IgA-seq, IgG-seq], blood single-cell RNA sequencing [scRNA-seq], and immune repertoire sequencing) to investigate the effects of 12 weeks of vitamin D on host immune microbe interactions in patients with IBD. Vitamin D treatment associates with decreased disease activity and inflammatory markers and increased IgA-bound and decreased IgG-bound gut microbiota. Vitamin D alters the profiles of IgA-bound (increased Lachnospiraceae, Blautia) and IgG-bound (decreased Proteobacteria, Enterococcaceae) gut bacteria. Vitamin D increases B cell activating factor (BAFF) signaling between plasmacytoid dendritic cells and B cells, alters BCR and TCR clonotypes that associate with Ig-bound gut microbiota, and increases α4β7+ B and T regulatory cells. Our results demonstrate that vitamin D promotes immune tolerance to gut microbiota in patients with IBD. Clinical trial is registered under NCT04828031.
doi:10.1016/j.xcrm.2026.102703 ↗ PMID 41895287 ↗ PMC13130636 ↗
Study facts
- Organism
- Homo sapiens
- Platform
- Illumina MiSeq
- Age group
- adult
- Disease groups
- Crohn's disease, Ulcerative colitis
- Anatomical sites
- —
Data availability
Specific data assets have not been resolved from the source yet — see the source repository below for the full file listing.
Strengths & limitations for reuse
Strengths
- Participant-to-sample mapping is available
- Participant counts are documented
- Sample counts are documented
Limitations
- Not documented: raw reads are advertised
- Not documented: feature/otu tables are advertised
- Not documented: taxonomic tables are advertised
Extraction evidence & provenance
Each extracted field is shown with the source excerpt and location used to resolve it.
Assay
| Field | Value | Evidence |
|---|---|---|
assay.paired_end |
True |
using 2 × 250 sequencing on an Illumina MiSeq Section |
assay.platform |
Illumina MiSeq |
performed at Novogene using 2 × 250 sequencing on an Illumina MiSeq Section |
assay.primers_reported |
True |
primer 515F/sequence GTGCCAGCMGCCGCGGTAA, primer 907R/sequence CCGTCAATTCCTTTGAGTTT Section |
assay.read_depth_reported |
1000 |
OTU tables were rarified at the sequencing depth of 1,000 sequences/sample. Section |
assay.read_length |
250 |
using 2 × 250 sequencing on an Illumina MiSeq Section |
assay.sequencing_type |
amplicon_16s |
Bacterial 16 S sequencing of the V4 and V5 regions Section |
assay.target_region |
V4-V5 |
Bacterial 16 S sequencing of the V4 and V5 regions Section |
Cohort
| Field | Value | Evidence |
|---|---|---|
cohort.age_group |
adult |
adult patients (18 years or older) with inflammatory bowel disease Section |
cohort.crohns_disease_participants |
21 computed |
About 56.3% of patients had ulcerative colitis (UC), whereas 43.7% had Crohn disease (CD). Section |
cohort.disease_activity_metadata_available |
True |
a decline in disease activity scores (partial mayo score for ulcerative colitis, −3.2; Harvey Bradshaw Index for Crohn disease, −3.3) Section |
cohort.study_design |
longitudinal |
from 48 patients with inflammatory bowel disease before and after vitamin D intervention Section |
cohort.total_participants |
48 |
Stool IgA-Seq and IgG-seq (16S sequening) from 48 patients with inflammatory bowel disease before and after vitamin D intervention Section |
cohort.treatment_exposure_documented |
True |
Patients were then treated with 50,000 units of oral vitamin D (ergocalciferol) once per week for 12 weeks. Section |
cohort.treatment_response_metadata_available |
True |
Twelve weeks of 50,000 units of oral vitamin D once per week led to a 20 point increase in serum 25(OH)D levels Section |
cohort.ulcerative_colitis_participants |
27 computed |
About 56.3% of patients had ulcerative colitis (UC), whereas 43.7% had Crohn disease (CD). Section |
Specimens
| Field | Value | Evidence |
|---|---|---|
specimens.inflamed_status_available |
True |
mean fecal calprotectin was 1,046.3 μg/g Section |
specimens.longitudinal_sampling |
True |
At the time of enrollment (week 0), patients had blood and stool samples collected... Blood and stool samples were collected at the end of study (week 12). Section |
specimens.number_of_samples |
96 computed |
from 48 patients with inflammatory bowel disease before and after vitamin D intervention Section |
specimens.participant_to_sample_mapping_available |
True |
Forty-eight patients with IBD completed the clinical trial and provided a full set of pre- and post-vitamin D treatment blood and stool samples Section |
specimens.sample_type |
stool |
Stool IgA-Seq and IgG-seq (16S sequening) Section |